"form template" 검색결과 1-20 / 822건

• 

  211125 겨울, PPT, 표지, 배경, 겨울표지, 눈오는, 눈, 겨울풍경, 예쁜, 깔끔, 감성, winter

  POWERPOINT TEMPLATE ... It's the best form I've ever made. I hope you use it pretty and have good results. ... It's the best form I've ever made. I hope you use it pretty and have good results.

  표지/속지 | 1페이지 | 1,000원 | 등록일 2021.11.25

  다운로드 장바구니
• 

  [웹서비스 프로그래밍][JSP] 팸플릿을 활용한 웹사이트 구현 보고서

  template.jsp ... pagefile=request.getParameter("page");//요청받은 것을 변수에 저장if(pagefile==null){pagefile="requestTest1_Form ... ";}%>／／없으면 requestTest1_Form 저장

  리포트 | 4페이지 | 1,000원 | 등록일 2023.04.07 | 수정일 2023.05.23

  다운로드 장바구니
• 

  해외 유학 지원 템플릿 application form (eng, abroad)

  GIL-DONG HONG Something-dong,Something-gu, Seoul Phone: +82-10-****-**** Email: ******** HYPERLINK \l "mailto:adgjm258015@gmail.com" @********** Linke..

  서식 | 2페이지 | 2,000원 | 등록일 2022.04.18

  다운로드 장바구니
• 

  [A+ 리포트] - PCR (분자생물학실험)

  P10 마이크로피펫을 이용하여 Template DNA 1µl를 따서 PCR 튜브에 가한다. P10 마이크로피펫을 이용하여 Primer F form(10pmole한다. ... DNA, Primer F form(10pmole), Primer R form(10pmole), BIOFACT Taq polymerase(5U/µl), NFW(Nuclease Free ... 튜브, PCR 튜브 Rack, Ep tube, 네임펜, Flake Ice, Ice bucket(pan), 10X Taq reaction buffer, 10mM dNTP mix, Template

  리포트 | 4페이지 | 1,000원 | 등록일 2022.12.23

  다운로드 장바구니
• 

  [일반생물학실험2] 1. PCR (Polymerase Chain Reaction)

  purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form ... purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form ... D.W 41.5 μl 10X reaction buffer 5 μl dNTP mix (10mM) 1 μl DNA template (100ng/㎕) 1 μl Forward primer

  리포트 | 5페이지 | 1,500원 | 등록일 2021.08.25

  다운로드 장바구니
• 

  [자료구조론]Queue를 이용한 미로찾기 과제

  소스 ※ Well-formed 판별 프로그램 /////////////////////////////////////////////QueType.h////////////////////// ... QueType.h에는 나중에 Enqueue와 Dequeue를 struct형으로 받아올것이기 때문에 template를 해준다. ... 클래스의 이름위와 각각의 메소드 위에는 template 문장을 써주고 Generic Date Type를 각각의 메소드에 써준다.

  리포트 | 24페이지 | 1,000원 | 등록일 2022.09.30

  다운로드 장바구니
• 

  PCR 전기영동 레포트- DNA

  ( 48 to 72℃ ) -Extension : Polymerase extends primer to form nascent DNA strand ( 68 to 72℃ ) *reference ... 실험 재료 PCR tube, dNT mix, 10X reaction buffer, Taq polymerase, DDW, primer FF/FR, DNA Template, Thermal ... polymerase 0.2 mu l+ DDW 12.8 mu l+ primer FF 1 mu l+ primer FR 1 mu l= 19 mu l 를 PCR tube에 넣고 DNA Template

  리포트 | 3페이지 | 1,500원 | 등록일 2020.11.03

  다운로드 장바구니
• 

  결과2_PCR A+ 결과레포트

  이러한 차이에 의하여 이동속도는 supercoiled form가 가장 빠르고 linear form, 가장 부피가 가장 큰 nicked open circular form은 가장 느리다 ... form(Plasmid의 두 가닥 중 한 가닥이 잘린 형태), linear form(Plasmid의 두 가닥 모두가 잘린 형태) 3가지 다른 구조의 DNA를 형성한다. ... 이번 실험에서는 pfu master mix, Nuclease free water, Forward primer, Reverse primer, DNA template를 레시피대로 넣어

  리포트 | 7페이지 | 2,000원 | 등록일 2020.07.06

  다운로드 장바구니
• 

  Silicon synthesis for anode- 전지 음극 실리콘 합성 논문 리뷰

  Front., 1 (2017) 1001 Hard-template based: impregnation and etching ... dissolved into the water and generated bubble: the liquid-vapor interface and collapse, acted as core template ... 0.5 ml/min Sigma-Aldrich (97%) 335150-25 3MPa, 1 h 470 o C, 3MPa, 1 h Decomposition of the SiO → To form

  리포트 | 18페이지 | 3,000원 | 등록일 2022.01.22 | 수정일 2022.01.26

  다운로드 장바구니
• 

  A학점 보장, 생화학 PCR 예비레포트, 자료 많음

  Template DNA가운데 원하고자 하는 부분의 염기서열에 정확히 대응하기 위해서 primer의 염기서열 제작 시 여러 가지 사항을 고려해야 한다. ... When RNA is the template, performing amplification in the same tube provides some normalization against ... When primers form intermolecular dimers much more readily than hybridizing to target DNA, they reduce

  리포트 | 24페이지 | 1,500원 | 등록일 2019.12.25

  다운로드 장바구니
• 

  [건국대학교] 의생명공학과 - 단백질공학 리포트(단백질조사)

  사람의 tPA는 한 개의 single chain form당 약 70kDa의 molecular weight을 가지고 있다. ... 우선 포유 동물 조직으로부터 DNA template를 isolate 하고, mRNA를 합성한 다음 reverse transcriptase를 이용해 cDNA 라이브러리를 확립한다.

  리포트 | 2페이지 | 2,000원 | 등록일 2024.05.25

  다운로드 장바구니
• 

  Restriction enzyme treatment and DNA digestion과 PCR (polymerase chain reaction) 실험 레포트

  DNA template, Taq polymerase(archeae의 DNA polymerase), template의 3'부분과 binding할 pirmer, dNTP(deoxynucleoside ... DNA의 electrophoresis band형태가 다름을 이용하여, 제대로 restriction된 linear form의 DNA를 electrophoresis결과에서 확인 할 수 ... enzyme의 작용, PCR의 원리를 알고, 얻어진 DNA fragment product를 electrophoresis를 통해 analysis하는 실험이다. plasmid형태와 linear form

  리포트 | 9페이지 | 2,500원 | 등록일 2020.12.13

  다운로드 장바구니
• 

  인천대학교 나노바이오실험(1) A 자료) 7. Bioinformation

  드래그하여 ‘ctrl+c’로 복사한다. ④ ‘File - new form clipboard’ 순서로 클릭한다. ⑤ 제목과 서열을 ‘– Translate – Frame 1’ 순서로 클릭한다 ... primer Tm GC% 60.04 55.00 60.03 55.00 Product length = 109 Forward primer 1 ATGCAGACTGTGCCACCTAC 20 Template

  리포트 | 18페이지 | 2,000원 | 등록일 2024.02.15

  다운로드 장바구니
• 

  유럽 의료기기 Field Safety Notice 양식 (Distributer, Importer Reply Form)

  Template for a Field Safety Notice Distributor/Importer Reply Form Distributor/Importer Reply Form Field ... Add quantity, Lot/Serial Number/Date Returned (same information as requested by the Customer Reply form ... Add quantity, Lot/Serial Number/Date Returned (same information as requested by the Customer Reply form

  서식 | 2페이지 | 500원 | 등록일 2022.03.19 | 수정일 2022.03.24

  다운로드 장바구니
• 

  PCR결과

  따라서 주형 DNA의 구조가 supercoiled form DNA 이었으므로 복제된 DNA의 실제 크기는 6 kbp이며 염기수는 6000개라는 것을 알 수 있다. ... PCR에 필요한 요소로는 template, primer, dNTP, pfu polymerase등이 있다. template는 증폭 대상이 되는 DNA로서 염기서열의 일부를 알고 있어야한다 ... DNA template를 단일가닥으로 만들기 위해서는 90°C 이상으로안정성이 매우 높은 DNA polymerase가 필요하다.

  리포트 | 2페이지 | 1,000원 | 등록일 2020.07.17

  다운로드 장바구니
• 

  The two Chicago schools

  CONCLUSION The Crowd seems to be the template not just for their overall theory even as they seek to ... public is more scattered and less completes, but it is evident that publics is a fundamentally different form

  리포트 | 1페이지 | 2,000원 | 등록일 2020.05.20

  다운로드 장바구니
• 

  [생화학 실습] 실습 예상문제 A+ 자료

  Neutralization ( S2 buffer 첨가로 염기성화 된 용액을 중화시킨다. ) 산성용액으로 pH를 급격히 7까지 복구시키면 크기가 작고 supercoiled form을 ... DNA를 희석시키기 위해서 물을 넣는다. - template : 증폭의 대상이 되는 DNA pcr 그래프 주어지고 각 단계에 대해서 쓰시오 - 94℃ ( 3분 ) : initial ... pfu-polymerase의 co - facter - pfu-polymerase : tag DNA pol 보다 신장활성은 낮으나 교정판독기능이 있어 오류가 보다 적게 나타난다. - : template

  시험자료 | 4페이지 | 2,000원 | 등록일 2020.09.22

  다운로드 장바구니
• 

  RT-PCR 예비레포트

  purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form ... Transcription Polymerase Chain Reaction) 실험목적 Reverse transcriptase를 이용히여 RNA를 cDNA로 전환시켜, 이 cDNA를 template로 ... PCR을 구성하고 있는 요소들로는 DNA template, primer, dNTP, polymerase등이 있으며, PCR 과정에서 그것의 sensitivity와 accuracy에

  리포트 | 3페이지 | 1,000원 | 등록일 2020.05.08

  다운로드 장바구니
• 

  분자세포생물학 기말범위에 대한 전반적인 단어입니다.

  interaction 발생, 이는 additional view of RNA structure - RNA strand does not remain hydrogen-bonded to DNA template ... RNA polymerase : catalyze formation of phosphodiester bonds that link the nucleotdies together and form ... double helix at traxes ▶ Intracellular condensates : RNA polymerases and RNA processing proteins also form

  시험자료 | 12페이지 | 2,000원 | 등록일 2023.05.18

  다운로드 장바구니
• 

  연세대학교 신소재공학과 소결공학 기말레포트

  Itemized Budget Template and Justification Al2O3의 원료가 되는 Bauxite를 한국에서는 채취할 수 없고 단가가 매우 비싸기 때문에(1톤에 480 ... . ● Forming 알루미나 시편을 성형하기 위해 Compression molding (압축성형)을 이용합니다. ... 이때 sintering 과정을 크게 Powder processing, Forming, Heating 세 과정으로 나누고, 각각의 단계에서 제품이 우수한 기계적 성질을 갖도록 치밀화를

  리포트 | 4페이지 | 2,000원 | 등록일 2022.04.14

  다운로드 장바구니